View Issue Details

IDProjectCategoryView StatusLast Update
0003915FreeCADBugpublic2020-03-27 13:17
Reporterstanicke Assigned To 
Status closedResolutionfixed 
Product Version0.18 
Summary0003915: Image does not get loaded in Image workbench
DescriptionNo image is shown or loaded and there are unhandled exceptions, I am sendinng the log below:

Msg: FreeCAD 0.18, Libs: 0.18R16093 (Git)
© Juergen Riegel, Werner Mayer, Yorik van Havre 2001-2019
  #####                 ####  ###   ####  
  #                    #      # #   #   # 
  #     ##  #### ####  #     #   #  #   # 
  ####  # # #  # #  #  #     #####  #   # 
  #     #   #### ####  #    #     # #   # 
  #     #   #    #     #    #     # #   #  ##  ##  ##
  #     #   #### ####   ### #     # ####   ##  ##  ##

Log: Time = Sun Mar 24 00:27:47 2019
Log: AppDataSkipVendor = true
Log: AppHomePath = C:/Program Files/FreeCAD 0.18/
Log: AppIcon = freecad
Log: AppTempPath = C:\Users\stana\AppData\Local\Temp\
Log: BinPath = C:/Program Files/FreeCAD 0.18/bin\
Log: BuildRepositoryURL = git:// releases/FreeCAD-0-18
Log: BuildRevision = 16093 (Git)
Log: BuildRevisionBranch = releases/FreeCAD-0-18
Log: BuildRevisionDate = 2019/03/12 13:38:07
Log: BuildRevisionHash = 690774c0effe4fd7b8d2b5e2fb2b8c8d145e21ce
Log: BuildVersionMajor = 0
Log: BuildVersionMinor = 18
Log: Console = 0
Log: CopyrightInfo = © Juergen Riegel, Werner Mayer, Yorik van Havre 2001-2019
  #####                 ####  ###   ####  
  #                    #      # #   #   # 
  #     ##  #### ####  #     #   #  #   # 
  ####  # # #  # #  #  #     #####  #   # 
  #     #   #### ####  #    #     # #   # 
  #     #   #    #     #    #     # #   #  ##  ##  ##
  #     #   #### ####   ### #     # ####   ##  ##  ##

Log: Debug = 0
Log: DocPath = C:/Program Files/FreeCAD 0.18/doc\
Log: ExeName = FreeCAD
Log: ExeVendor = FreeCAD
Log: ExeVersion = 0.18
Log: LoggingFile = 1
Log: LoggingFileName = C:\Users\stana\AppData\Roaming\FreeCAD\FreeCAD.log
Log: MaintainerUrl =
Log: PATH = C:\Program Files\FreeCAD 0.18\bin\Library\bin;C:\Program Files\Python36\Scripts\;C:\Program Files\Python36\;C:\Program Files\Ruby24-x64\bin;C:\ProgramData\Oracle\Java\javapath;C:\Program Files\ImageMagick-6.9.2-Q16;C:\Program Files (x86)\Intel\iCLS Client\;C:\Program Files\Intel\iCLS Client\;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\Program Files\Intel\Intel(R) Management Engine Components\DAL;C:\Program Files\Intel\Intel(R) Management Engine Components\IPT;C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\DAL;C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\IPT;C:\Program Files (x86)\Toshiba\Bluetooth Toshiba Stack\sys\;C:\Program Files (x86)\Toshiba\Bluetooth Toshiba Stack\sys\x64\;c:\Program Files (x86)\gs\gs9.18\bin;C:\Program Files\LuxRender;C:\Program Files (x86)\GNU\GnuPG\pub;C:\WINDOWS\System32\WindowsPowerShell\v1.0\;C:\Program Files (x86)\Windows Kits\8.1\Windows Performance Toolkit\;C:\WINDOWS\System32\WindowsPowerShell\v1.0\;C:\WINDOWS\System32\OpenSSH\;C:\Program Files\Microsoft VS Code\bin;C:\Program Files\Intel\WiFi\bin\;C:\Program Files\Common Files\Intel\WirelessCommon\;C:\Users\stana\scoop\apps\nodejs-lts\current\bin;C:\Users\stana\scoop\apps\nodejs-lts\current;C:\Users\stana\scoop\apps\imagemagick\current;C:\Users\stana\scoop\shims;%USERPROFILE%\AppData\Local\Microsoft\WindowsApps;
Log: PythonSearchPath = C:\Program Files\FreeCAD 0.18\bin\;C:\Program Files\FreeCAD 0.18\bin\DLLs;C:\Program Files\FreeCAD 0.18\bin\lib;C:\Program Files\FreeCAD 0.18\bin
Log: RunMode = Gui
Log: SplashAlignment = Bottom|Left
Log: SplashInfoColor = #c8c8c8
Log: SplashScreen = freecadsplash
Log: SplashTextColor = #ffffff
Log: StartWorkbench = StartWorkbench
Log: SystemParameter = C:\Users\stana\AppData\Roaming\FreeCAD\system.cfg
Log: UserAppData = C:\Users\stana\AppData\Roaming\FreeCAD\
Log: UserHomePath = C:\Users\stana\Documents
Log: UserParameter = C:\Users\stana\AppData\Roaming\FreeCAD\user.cfg
Log: Verbose = 
Log: Create Application
Log: Run App init script
Log: Init: starting
Log: Init:   Searching for modules...
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\AddonManager... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Arch... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Complete... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Draft... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Drawing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Fem... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Idf... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Image... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Import... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Inspection... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Material... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Measure... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Mesh... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\MeshPart... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\OpenSCAD... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Part... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\PartDesign... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Path... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Plot( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Points... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Raytracing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Robot... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Ship( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Show( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Sketcher... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Spreadsheet... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Start... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Surface... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\TechDraw... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Test... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Tux( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Web... done
Log: Using C:\Program Files\FreeCAD 0.18\Mod as module path!
Log: System path after init:
Log:    C:\Program Files\FreeCAD 0.18\bin
Log:    C:\Program Files\FreeCAD 0.18\Mod\AddonManager
Log:    C:\Program Files\FreeCAD 0.18\Mod\Arch
Log:    C:\Program Files\FreeCAD 0.18\Mod\Complete
Log:    C:\Program Files\FreeCAD 0.18\Mod\Draft
Log:    C:\Program Files\FreeCAD 0.18\Mod\Drawing
Log:    C:\Program Files\FreeCAD 0.18\Mod\Fem
Log:    C:\Program Files\FreeCAD 0.18\Mod\Idf
Log:    C:\Program Files\FreeCAD 0.18\Mod\Image
Log:    C:\Program Files\FreeCAD 0.18\Mod\Import
Log:    C:\Program Files\FreeCAD 0.18\Mod\Inspection
Log:    C:\Program Files\FreeCAD 0.18\Mod\Material
Log:    C:\Program Files\FreeCAD 0.18\Mod\Measure
Log:    C:\Program Files\FreeCAD 0.18\Mod\Mesh
Log:    C:\Program Files\FreeCAD 0.18\Mod\MeshPart
Log:    C:\Program Files\FreeCAD 0.18\Mod\OpenSCAD
Log:    C:\Program Files\FreeCAD 0.18\Mod\Part
Log:    C:\Program Files\FreeCAD 0.18\Mod\PartDesign
Log:    C:\Program Files\FreeCAD 0.18\Mod\Path
Log:    C:\Program Files\FreeCAD 0.18\Mod\Plot
Log:    C:\Program Files\FreeCAD 0.18\Mod\Points
Log:    C:\Program Files\FreeCAD 0.18\Mod\Raytracing
Log:    C:\Program Files\FreeCAD 0.18\Mod\Robot
Log:    C:\Program Files\FreeCAD 0.18\Mod\Ship
Log:    C:\Program Files\FreeCAD 0.18\Mod\Show
Log:    C:\Program Files\FreeCAD 0.18\Mod\Sketcher
Log:    C:\Program Files\FreeCAD 0.18\Mod\Spreadsheet
Log:    C:\Program Files\FreeCAD 0.18\Mod\Start
Log:    C:\Program Files\FreeCAD 0.18\Mod\Surface
Log:    C:\Program Files\FreeCAD 0.18\Mod\TechDraw
Log:    C:\Program Files\FreeCAD 0.18\Mod\Test
Log:    C:\Program Files\FreeCAD 0.18\Mod\Tux
Log:    C:\Program Files\FreeCAD 0.18\Mod\Web
Log:    C:\Program Files\FreeCAD 0.18\bin\Library\bin
Log:    C:\Program Files\Python36\Scripts\
Log:    C:\Program Files\Python36\
Log:    C:\Program Files\Ruby24-x64\bin
Log:    C:\ProgramData\Oracle\Java\javapath
Log:    C:\Program Files\ImageMagick-6.9.2-Q16
Log:    C:\Program Files (x86)\Intel\iCLS Client\
Log:    C:\Program Files\Intel\iCLS Client\
Log:    C:\WINDOWS\system32
Log:    C:\WINDOWS
Log:    C:\WINDOWS\System32\Wbem
Log:    C:\Program Files\Intel\Intel(R) Management Engine Components\DAL
Log:    C:\Program Files\Intel\Intel(R) Management Engine Components\IPT
Log:    C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\DAL
Log:    C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\IPT
Log:    C:\Program Files (x86)\Toshiba\Bluetooth Toshiba Stack\sys\
Log:    C:\Program Files (x86)\Toshiba\Bluetooth Toshiba Stack\sys\x64\
Log:    c:\Program Files (x86)\gs\gs9.18\bin
Log:    C:\Program Files\LuxRender
Log:    C:\Program Files (x86)\GNU\GnuPG\pub
Log:    C:\WINDOWS\System32\WindowsPowerShell\v1.0\
Log:    C:\Program Files (x86)\Windows Kits\8.1\Windows Performance Toolkit\
Log:    C:\WINDOWS\System32\WindowsPowerShell\v1.0\
Log:    C:\WINDOWS\System32\OpenSSH\
Log:    C:\Program Files\Microsoft VS Code\bin
Log:    C:\Program Files\Intel\WiFi\bin\
Log:    C:\Program Files\Common Files\Intel\WirelessCommon\
Log:    C:\Users\stana\scoop\apps\nodejs-lts\current\bin
Log:    C:\Users\stana\scoop\apps\nodejs-lts\current
Log:    C:\Users\stana\scoop\apps\imagemagick\current
Log:    C:\Users\stana\scoop\shims
Log:    %USERPROFILE%\AppData\Local\Microsoft\WindowsApps
Log: Init: done
Log: Init: Creating Gui::Application and QApplication
Log: Local server 'FreeCAD' started
Log: OpenGL version is: 4.3 (4.3.0 - Build
Log: Run Gui init script
Log: Init: Running start script...
Log: Init:   Searching modules...
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\AddonManager... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Arch... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Complete... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Draft... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Drawing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Fem... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Idf( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Image... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Import... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Inspection... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Material... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Measure( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Mesh... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\MeshPart... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\OpenSCAD... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Part... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\PartDesign... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Path... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Plot... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Points... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Raytracing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Robot... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Ship... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Show( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Sketcher... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Spreadsheet... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Start... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Surface... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\TechDraw... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Test... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Tux... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Web... done
Log: Init: Loading FreeCAD GUI
Log: Init: Running start script... done
Log: Init: Activating default workbench StartWorkbench
Log: Loading GUI of Web module... done
Log: Loading GUI of Start module... done
Log: Loading Start module... done
Log: Init: Showing main window
Log: Main window restored
Log: Show main window
Log: Toolbars restored
Log: 3Dconnexion device not attached.
Log: Init: Entering event loop
Log: Init: Processing command line files
Log: Loading GUI of Image module... done
Log: Module: Part
Log: Loading Part module... done
Log: Loading Image module... done
Log: QFSFileEngine::open: No file name specified
Err: Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
Log: The event type 12 was sent to QOpenGLWidget
Object tree:
    QOpenGLWidget is child of
    SIM::Coin3D::Quarter::QuarterWidget is child of
    QStackedWidget is child of
    Gui::View3DInventor is child of
    QMdiSubWindow is child of
    QWidget is child of
    QMdiArea is child of
    Gui::MainWindowErr: Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
Log: The event type 12 was sent to QOpenGLWidget
Object tree:
    QOpenGLWidget is child of
    SIM::Coin3D::Quarter::QuarterWidget is child of
    QStackedWidget is child of
    Gui::View3DInventor is child of
    QMdiSubWindow is child of
    QWidget is child of
    QMdiArea is child of
Steps To ReproduceHow to reproduce:
1. launch freecad
2. start with new file
3. Switch to Image workbench
4. Click on "Create a planar image in the 3d space"
5. Select an jpg image an click Ok
FreeCAD Information


related to 0003917 new PartDesign Version 0.18 fails to display drawing, shows exceptions in log file. 
has duplicate 0004163 closedKunda1 FreeCAD Workbench Image not working 



2019-03-23 23:33


FreeCAD.log (15,125 bytes)   
Msg: FreeCAD 0.18, Libs: 0.18R16093 (Git)
© Juergen Riegel, Werner Mayer, Yorik van Havre 2001-2019
  #####                 ####  ###   ####  
  #                    #      # #   #   # 
  #     ##  #### ####  #     #   #  #   # 
  ####  # # #  # #  #  #     #####  #   # 
  #     #   #### ####  #    #     # #   # 
  #     #   #    #     #    #     # #   #  ##  ##  ##
  #     #   #### ####   ### #     # ####   ##  ##  ##

Log: Time = Sun Mar 24 00:27:47 2019
Log: AppDataSkipVendor = true
Log: AppHomePath = C:/Program Files/FreeCAD 0.18/
Log: AppIcon = freecad
Log: AppTempPath = C:\Users\stana\AppData\Local\Temp\
Log: BinPath = C:/Program Files/FreeCAD 0.18/bin\
Log: BuildRepositoryURL = git:// releases/FreeCAD-0-18
Log: BuildRevision = 16093 (Git)
Log: BuildRevisionBranch = releases/FreeCAD-0-18
Log: BuildRevisionDate = 2019/03/12 13:38:07
Log: BuildRevisionHash = 690774c0effe4fd7b8d2b5e2fb2b8c8d145e21ce
Log: BuildVersionMajor = 0
Log: BuildVersionMinor = 18
Log: Console = 0
Log: CopyrightInfo = © Juergen Riegel, Werner Mayer, Yorik van Havre 2001-2019
  #####                 ####  ###   ####  
  #                    #      # #   #   # 
  #     ##  #### ####  #     #   #  #   # 
  ####  # # #  # #  #  #     #####  #   # 
  #     #   #### ####  #    #     # #   # 
  #     #   #    #     #    #     # #   #  ##  ##  ##
  #     #   #### ####   ### #     # ####   ##  ##  ##

Log: Debug = 0
Log: DocPath = C:/Program Files/FreeCAD 0.18/doc\
Log: ExeName = FreeCAD
Log: ExeVendor = FreeCAD
Log: ExeVersion = 0.18
Log: LoggingFile = 1
Log: LoggingFileName = C:\Users\stana\AppData\Roaming\FreeCAD\FreeCAD.log
Log: MaintainerUrl =
Log: PATH = C:\Program Files\FreeCAD 0.18\bin\Library\bin;C:\Program Files\Python36\Scripts\;C:\Program Files\Python36\;C:\Program Files\Ruby24-x64\bin;C:\ProgramData\Oracle\Java\javapath;C:\Program Files\ImageMagick-6.9.2-Q16;C:\Program Files (x86)\Intel\iCLS Client\;C:\Program Files\Intel\iCLS Client\;C:\WINDOWS\system32;C:\WINDOWS;C:\WINDOWS\System32\Wbem;C:\Program Files\Intel\Intel(R) Management Engine Components\DAL;C:\Program Files\Intel\Intel(R) Management Engine Components\IPT;C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\DAL;C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\IPT;C:\Program Files (x86)\Toshiba\Bluetooth Toshiba Stack\sys\;C:\Program Files (x86)\Toshiba\Bluetooth Toshiba Stack\sys\x64\;c:\Program Files (x86)\gs\gs9.18\bin;C:\Program Files\LuxRender;C:\Program Files (x86)\GNU\GnuPG\pub;C:\WINDOWS\System32\WindowsPowerShell\v1.0\;C:\Program Files (x86)\Windows Kits\8.1\Windows Performance Toolkit\;C:\WINDOWS\System32\WindowsPowerShell\v1.0\;C:\WINDOWS\System32\OpenSSH\;C:\Program Files\Microsoft VS Code\bin;C:\Program Files\Intel\WiFi\bin\;C:\Program Files\Common Files\Intel\WirelessCommon\;C:\Users\stana\scoop\apps\nodejs-lts\current\bin;C:\Users\stana\scoop\apps\nodejs-lts\current;C:\Users\stana\scoop\apps\imagemagick\current;C:\Users\stana\scoop\shims;%USERPROFILE%\AppData\Local\Microsoft\WindowsApps;
Log: PythonSearchPath = C:\Program Files\FreeCAD 0.18\bin\;C:\Program Files\FreeCAD 0.18\bin\DLLs;C:\Program Files\FreeCAD 0.18\bin\lib;C:\Program Files\FreeCAD 0.18\bin
Log: RunMode = Gui
Log: SplashAlignment = Bottom|Left
Log: SplashInfoColor = #c8c8c8
Log: SplashScreen = freecadsplash
Log: SplashTextColor = #ffffff
Log: StartWorkbench = StartWorkbench
Log: SystemParameter = C:\Users\stana\AppData\Roaming\FreeCAD\system.cfg
Log: UserAppData = C:\Users\stana\AppData\Roaming\FreeCAD\
Log: UserHomePath = C:\Users\stana\Documents
Log: UserParameter = C:\Users\stana\AppData\Roaming\FreeCAD\user.cfg
Log: Verbose = 
Log: Create Application
Log: Run App init script
Log: Init: starting
Log: Init:   Searching for modules...
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\AddonManager... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Arch... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Complete... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Draft... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Drawing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Fem... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Idf... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Image... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Import... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Inspection... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Material... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Measure... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Mesh... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\MeshPart... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\OpenSCAD... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Part... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\PartDesign... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Path... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Plot( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Points... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Raytracing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Robot... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Ship( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Show( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Sketcher... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Spreadsheet... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Start... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Surface... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\TechDraw... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Test... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Tux( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Web... done
Log: Using C:\Program Files\FreeCAD 0.18\Mod as module path!
Log: System path after init:
Log:    C:\Program Files\FreeCAD 0.18\bin
Log:    C:\Program Files\FreeCAD 0.18\Mod\AddonManager
Log:    C:\Program Files\FreeCAD 0.18\Mod\Arch
Log:    C:\Program Files\FreeCAD 0.18\Mod\Complete
Log:    C:\Program Files\FreeCAD 0.18\Mod\Draft
Log:    C:\Program Files\FreeCAD 0.18\Mod\Drawing
Log:    C:\Program Files\FreeCAD 0.18\Mod\Fem
Log:    C:\Program Files\FreeCAD 0.18\Mod\Idf
Log:    C:\Program Files\FreeCAD 0.18\Mod\Image
Log:    C:\Program Files\FreeCAD 0.18\Mod\Import
Log:    C:\Program Files\FreeCAD 0.18\Mod\Inspection
Log:    C:\Program Files\FreeCAD 0.18\Mod\Material
Log:    C:\Program Files\FreeCAD 0.18\Mod\Measure
Log:    C:\Program Files\FreeCAD 0.18\Mod\Mesh
Log:    C:\Program Files\FreeCAD 0.18\Mod\MeshPart
Log:    C:\Program Files\FreeCAD 0.18\Mod\OpenSCAD
Log:    C:\Program Files\FreeCAD 0.18\Mod\Part
Log:    C:\Program Files\FreeCAD 0.18\Mod\PartDesign
Log:    C:\Program Files\FreeCAD 0.18\Mod\Path
Log:    C:\Program Files\FreeCAD 0.18\Mod\Plot
Log:    C:\Program Files\FreeCAD 0.18\Mod\Points
Log:    C:\Program Files\FreeCAD 0.18\Mod\Raytracing
Log:    C:\Program Files\FreeCAD 0.18\Mod\Robot
Log:    C:\Program Files\FreeCAD 0.18\Mod\Ship
Log:    C:\Program Files\FreeCAD 0.18\Mod\Show
Log:    C:\Program Files\FreeCAD 0.18\Mod\Sketcher
Log:    C:\Program Files\FreeCAD 0.18\Mod\Spreadsheet
Log:    C:\Program Files\FreeCAD 0.18\Mod\Start
Log:    C:\Program Files\FreeCAD 0.18\Mod\Surface
Log:    C:\Program Files\FreeCAD 0.18\Mod\TechDraw
Log:    C:\Program Files\FreeCAD 0.18\Mod\Test
Log:    C:\Program Files\FreeCAD 0.18\Mod\Tux
Log:    C:\Program Files\FreeCAD 0.18\Mod\Web
Log:    C:\Program Files\FreeCAD 0.18\bin\Library\bin
Log:    C:\Program Files\Python36\Scripts\
Log:    C:\Program Files\Python36\
Log:    C:\Program Files\Ruby24-x64\bin
Log:    C:\ProgramData\Oracle\Java\javapath
Log:    C:\Program Files\ImageMagick-6.9.2-Q16
Log:    C:\Program Files (x86)\Intel\iCLS Client\
Log:    C:\Program Files\Intel\iCLS Client\
Log:    C:\WINDOWS\system32
Log:    C:\WINDOWS
Log:    C:\WINDOWS\System32\Wbem
Log:    C:\Program Files\Intel\Intel(R) Management Engine Components\DAL
Log:    C:\Program Files\Intel\Intel(R) Management Engine Components\IPT
Log:    C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\DAL
Log:    C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\IPT
Log:    C:\Program Files (x86)\Toshiba\Bluetooth Toshiba Stack\sys\
Log:    C:\Program Files (x86)\Toshiba\Bluetooth Toshiba Stack\sys\x64\
Log:    c:\Program Files (x86)\gs\gs9.18\bin
Log:    C:\Program Files\LuxRender
Log:    C:\Program Files (x86)\GNU\GnuPG\pub
Log:    C:\WINDOWS\System32\WindowsPowerShell\v1.0\
Log:    C:\Program Files (x86)\Windows Kits\8.1\Windows Performance Toolkit\
Log:    C:\WINDOWS\System32\WindowsPowerShell\v1.0\
Log:    C:\WINDOWS\System32\OpenSSH\
Log:    C:\Program Files\Microsoft VS Code\bin
Log:    C:\Program Files\Intel\WiFi\bin\
Log:    C:\Program Files\Common Files\Intel\WirelessCommon\
Log:    C:\Users\stana\scoop\apps\nodejs-lts\current\bin
Log:    C:\Users\stana\scoop\apps\nodejs-lts\current
Log:    C:\Users\stana\scoop\apps\imagemagick\current
Log:    C:\Users\stana\scoop\shims
Log:    %USERPROFILE%\AppData\Local\Microsoft\WindowsApps
Log: Init: done
Log: Init: Creating Gui::Application and QApplication
Log: Local server 'FreeCAD' started
Log: OpenGL version is: 4.3 (4.3.0 - Build
Log: Run Gui init script
Log: Init: Running start script...
Log: Init:   Searching modules...
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\AddonManager... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Arch... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Complete... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Draft... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Drawing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Fem... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Idf( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Image... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Import... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Inspection... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Material... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Measure( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Mesh... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\MeshPart... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\OpenSCAD... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Part... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\PartDesign... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Path... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Plot... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Points... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Raytracing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Robot... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Ship... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Show( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Sketcher... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Spreadsheet... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Start... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Surface... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\TechDraw... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Test... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Tux... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Web... done
Log: Init: Loading FreeCAD GUI
Log: Init: Running start script... done
Log: Init: Activating default workbench StartWorkbench
Log: Loading GUI of Web module... done
Log: Loading GUI of Start module... done
Log: Loading Start module... done
Log: Init: Showing main window
Log: Main window restored
Log: Show main window
Log: Toolbars restored
Log: 3Dconnexion device not attached.
Log: Init: Entering event loop
Log: Init: Processing command line files
Log: Loading GUI of Image module... done
Log: Module: Part
Log: Loading Part module... done
Log: Loading Image module... done
Log: QFSFileEngine::open: No file name specified
Err: Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
Log: The event type 12 was sent to QOpenGLWidget
Object tree:
	QOpenGLWidget is child of
	SIM::Coin3D::Quarter::QuarterWidget is child of
	QStackedWidget is child of
	Gui::View3DInventor is child of
	QMdiSubWindow is child of
	QWidget is child of
	QMdiArea is child of
	Gui::MainWindowErr: Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
Log: The event type 12 was sent to QOpenGLWidget
Object tree:
	QOpenGLWidget is child of
	SIM::Coin3D::Quarter::QuarterWidget is child of
	QStackedWidget is child of
	Gui::View3DInventor is child of
	QMdiSubWindow is child of
	QWidget is child of
	QMdiArea is child of
	Gui::MainWindowErr: Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
Log: The event type 12 was sent to QOpenGLWidget
Object tree:
	QOpenGLWidget is child of
	SIM::Coin3D::Quarter::QuarterWidget is child of
	QStackedWidget is child of
	Gui::View3DInventor is child of
	QMdiSubWindow is child of
	QWidget is child of
	QMdiArea is child of
	Gui::MainWindowErr: Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
Log: The event type 12 was sent to QOpenGLWidget
Object tree:
	QOpenGLWidget is child of
	SIM::Coin3D::Quarter::QuarterWidget is child of
	QStackedWidget is child of
	Gui::View3DInventor is child of
	QMdiSubWindow is child of
	QWidget is child of
	QMdiArea is child of
FreeCAD.log (15,125 bytes)   


2019-03-23 23:37

reporter   ~0012946

Last edited: 2019-09-24 13:10

View 2 revisions

I am also adding the Python console below:

Python 3.6.6 | packaged by conda-forge | (default, Jul 26 2018, 11:48:23) [MSC v.1900 64 bit (AMD64)] on win32
Type 'help', 'copyright', 'credits' or 'license' for more information.
>>> exec(open('C:/Program Files/FreeCAD 0.18/data/Mod/Start/StartPage/').read())
>>> App.setActiveDocument("Unnamed")
>>> App.ActiveDocument=App.getDocument("Unnamed")
>>> Gui.ActiveDocument=Gui.getDocument("Unnamed")
>>> Gui.activateWorkbench("ImageWorkbench")
>>> App.activeDocument().addObject('Image::ImagePlane','ImagePlane')
>>> App.activeDocument().ImagePlane.ImageFile = 'C:/Users/stana/Downloads/RD 10 pudorys-page-001.jpg'
>>> App.activeDocument().ImagePlane.XSize = 76
>>> App.activeDocument().ImagePlane.YSize = 54
>>> App.activeDocument().ImagePlane.Placement = App.Placement(App.Vector(0.000000,0.000000,0.000000),App.Rotation(0.000000,0.000000,0.000000,1.000000))
>>> Gui.SendMsgToActiveView('ViewFit')


2019-03-24 07:52

reporter   ~0012947

BIG. YELLOW. BANNER. why do people not read :(


2019-03-25 16:41

reporter   ~0012949

I have read it, still I do not know what I did incorrectly, but I admit I might have. Anyway, since you could reply you might have written the actual fact what is wrong and for the next time, you would have +1 person educated. Currently, I do not know:
1. What I did wrong
2. If you will somehow elaborate on this ticket
3. If I should report bugs or not


2019-03-25 19:33

reporter   ~0012950

I accidentally closed my banner so can't respond correctly but:
1. No FreeCAD version info from Help/About FreeCAD/Copy to clipboard. Some of it is in the log but still...
2. No forum discussion
3. This ticket is created as bug.
4. The forum discussion might have shown something simmilar happening with other users. For example today another user was having similar problem that gave this type of error:

Log: The event type 12 was sent to QOpenGLWidget
Object tree:
    QOpenGLWidget is child of
    SIM::Coin3D::Quarter::QuarterWidget is child of
    QStackedWidget is child of
    Gui::View3DInventor is child of
    QMdiSubWindow is child of
    QWidget is child of
    QMdiArea is child of
    Gui::MainWindowErr: Unhandled Base::Exception caught in GUIApplication::notify.

This was with a file that I posted and works ok here (Win8, NVidia laptop, latest freecad). I can also create imageplane without any problems with your FreeCAD version. So it might be a problem with video driver, os, openglconfiguration,... Which is best discussed in the forum with wider visibility and ability to test.

While writing this I made a test - run FreeCAD with integrated Intel graphics. And I got the same error. There is a problem. But is it in the drivers, QT opengl widget or the way FreeCAD uses it? best to discus in the forum and when properly identified report the problem with meaningful title so the devs could tackle it fast.


2019-03-25 20:08

reporter   ~0012951

Last edited: 2019-03-25 20:12

View 2 revisions

I forgot that I already posted the same topic in the forum Loading image gives Access violation
Are you using an integrated graphics to run FreeCAD? Which card? Can you try to run it with Nvidia card?


2019-03-25 20:24

reporter   ~0012952

Yes, should be Intel® HD Graphics 4400 .

Below my FreeCAD | About:

OS: Windows 10
Word size of OS: 64-bit
Word size of FreeCAD: 64-bit
Version: 0.18.16093 (Git)
Build type: Release
Branch: releases/FreeCAD-0-18
Hash: 690774c0effe4fd7b8d2b5e2fb2b8c8d145e21ce
Python version: 3.6.6
Qt version: 5.6.2
Coin version: 4.0.0a
OCC version: 7.3.0
Locale: Czech/CzechRepublic (cs_CZ)

Can provide more info if you want, just let me know.


2019-03-25 20:26

reporter   ~0012953

Sorry, I have no access to NVidia currently, all my laptops have Intel integrated :-(


2019-03-26 09:55

administrator   ~0012954

Marking ticket as 'Feedback' as we wait for @stanicke reply.


2019-03-26 10:38

reporter   ~0012960

@Kunda1 I already provided the reply to the questions:
- I am using Intel® HD Graphics 4400 .
- No I have no access to NVidia card :-(.

Should I provide something else?


2019-03-26 11:20

reporter   ~0012961

@stanicke could you try both files from 0003917


2019-03-26 12:08

reporter   ~0012963

Both files work without any problems - I can open, rotate, show/hide sketches, no exception raised during whatever I did.


2019-04-01 20:13

reporter   ~0012983

Last edited: 2019-04-03 15:03

View 2 revisions

I experience the same problem with intel integrated graphics HD 520. in a Lenovo L560 laptop.

But I having difficulties to roll back to an older driver.

UPDATE: I've downgraded the Intel HD520 graphics Driver for win8.1 and tested the versions: (most recent November 2018) (oldest 2016)

The Unhandled exeption error persist. I'v also tested the next version with same error.
OS: Windows 8.1
Word size of OS: 64-bit
Word size of FreeCAD: 64-bit
Version: 0.19.16267 (Git)
Build type: Release
Branch: master
Hash: ddb335cfe057336f1958d68126bb0471328d735c
Python version: 3.6.6
Qt version: 5.6.2
Coin version: 4.0.0a
OCC version: 7.3.0

Here is a link to the discussion.


2019-04-24 20:22

reporter   ~0013048

Just installed the latest available official build and I see the same phenomenon.

OS: Windows 7
Word size of OS: 64-bit
Word size of FreeCAD: 64-bit
Version: 0.18.16110 (Git)
Build type: Release
Branch: (HEAD detached at upstream/releases/FreeCAD-0-18)
Hash: f7dccfaa909e5b9da26bf50c4a22ccca9bb10c40
Python version: 3.6.6
Qt version: 5.6.2
Coin version: 4.0.0a
OCC version: 7.3.0
Locale: English/Canada (en_CA)

using an AMD Radeon

Radeon Software Version - 17.12.1
Radeon Software Edition - Adrenalin
Graphics Chipset - AMD Radeon(TM) R7 350X
Memory Size - 4096 MB
Memory Type - DDR3
Core Clock - 1050 MHz
Windows Version - Windows 7 (Service Pack 1) (64 bit)
System Memory - 16 GB
CPU Type - Intel(R) Core(TM) i7-6700 CPU @ 3.40GHz

After attempting to load an image, which throws the first exception, any subsequent display area interaction shows another exception, e.g. changing tabs (See log.)
FreeCAD-2.log (21,394 bytes)   
Msg: FreeCAD 0.18, Libs: 0.18R16110 (Git)
© Juergen Riegel, Werner Mayer, Yorik van Havre 2001-2019
  #####                 ####  ###   ####  
  #                    #      # #   #   # 
  #     ##  #### ####  #     #   #  #   # 
  ####  # # #  # #  #  #     #####  #   # 
  #     #   #### ####  #    #     # #   # 
  #     #   #    #     #    #     # #   #  ##  ##  ##
  #     #   #### ####   ### #     # ####   ##  ##  ##

Log: Time = Wed Apr 24 16:14:46 2019
Log: AppDataSkipVendor = true
Log: AppHomePath = C:/Program Files/FreeCAD 0.18/
Log: AppIcon = freecad
Log: AppTempPath = C:\Users\hgutsche\AppData\Local\Temp\
Log: BinPath = C:/Program Files/FreeCAD 0.18/bin\
Log: BuildRepositoryURL = git://
Log: BuildRevision = 16110 (Git)
Log: BuildRevisionBranch = (HEAD detached at upstream/releases/FreeCAD-0-18)
Log: BuildRevisionDate = 2019/04/04 13:42:43
Log: BuildRevisionHash = f7dccfaa909e5b9da26bf50c4a22ccca9bb10c40
Log: BuildVersionMajor = 0
Log: BuildVersionMinor = 18
Log: Console = 0
Log: CopyrightInfo = © Juergen Riegel, Werner Mayer, Yorik van Havre 2001-2019
  #####                 ####  ###   ####  
  #                    #      # #   #   # 
  #     ##  #### ####  #     #   #  #   # 
  ####  # # #  # #  #  #     #####  #   # 
  #     #   #### ####  #    #     # #   # 
  #     #   #    #     #    #     # #   #  ##  ##  ##
  #     #   #### ####   ### #     # ####   ##  ##  ##

Log: Debug = 0
Log: DocPath = C:/Program Files/FreeCAD 0.18/doc\
Log: ExeName = FreeCAD
Log: ExeVendor = FreeCAD
Log: ExeVersion = 0.18
Log: LoggingFile = 1
Log: LoggingFileName = C:\Users\hgutsche\AppData\Roaming\FreeCAD\FreeCAD.log
Log: MaintainerUrl =
Log: PATH = C:\Program Files\FreeCAD 0.18\bin\Library\bin;C:\Python37\Scripts\;C:\Python37\;C:\Perl64\site\bin;C:\Perl64\bin;C:\Program Files (x86)\Intel\iCLS Client\;C:\Program Files\Intel\iCLS Client\;C:\Windows\system32;C:\Windows;C:\Windows\System32\Wbem;C:\Windows\System32\WindowsPowerShell\v1.0\;C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\DAL;C:\Program Files\Intel\Intel(R) Management Engine Components\DAL;C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\IPT;C:\Program Files\Intel\Intel(R) Management Engine Components\IPT;c:\Program Files (x86)\ATI Technologies\ATI.ACE\Core-Static;C:\Program Files\Microsoft SQL Server\110\Tools\Binn\;C:\Program Files (x86)\Microsoft SDKs\TypeScript\1.0\;C:\Program Files\doxygen\bin;C:\Program Files (x86)\QT Lite\QTSystem;C:\Program Files\Perforce\;C:\SOLEXORB\SOLEX121;D:\Astronomy\SOLEX121;C:\Program Files\MiKTeX 2.9\miktex\bin\x64\;C:\Program Files\Microsoft SQL Server\130\Tools\Binn\;C:\Python37\Scripts\;C:\Python37\;C:\Perl64\site\bin;C:\Perl64\bin;C:\Program Files (x86)\Intel\iCLS Client\;C:\Program Files\Intel\iCLS Client\;C:\Windows\system32;C:\Windows;C:\Windows\System32\Wbem;C:\Windows\System32\WindowsPowerShell\v1.0\;C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\DAL;C:\Program Files\Intel\Intel(R) Management Engine Components\DAL;C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\IPT;C:\Program Files\Intel\Intel(R) Management Engine Components\IPT;c:\Program Files (x86)\ATI Technologies\ATI.ACE\Core-Static;C:\Program Files\Microsoft SQL Server\110\Tools\Binn\;C:\Program Files (x86)\Microsoft SDKs\TypeScript\1.0\;C:\Program Files\doxygen\bin;C:\Program Files (x86)\QT Lite\QTSystem;C:\Program Files\Perforce\;C:\SOLEXORB\SOLEX121;D:\Astronomy\SOLEX121;C:\Program Files\MiKTeX 2.9\miktex\bin\x64\;C:\Program Files\Microsoft SQL Server\130\Tools\Binn\;C:\Program Files\CMake\bin;
Log: PythonSearchPath = C:\Program Files\FreeCAD 0.18\bin\;C:\Program Files\FreeCAD 0.18\bin\DLLs;C:\Program Files\FreeCAD 0.18\bin\lib;C:\Program Files\FreeCAD 0.18\bin
Log: RunMode = Gui
Log: SplashAlignment = Bottom|Left
Log: SplashInfoColor = #c8c8c8
Log: SplashScreen = freecadsplash
Log: SplashTextColor = #ffffff
Log: StartWorkbench = StartWorkbench
Log: SystemParameter = C:\Users\hgutsche\AppData\Roaming\FreeCAD\system.cfg
Log: UserAppData = C:\Users\hgutsche\AppData\Roaming\FreeCAD\
Log: UserHomePath = C:\Users\hgutsche\Documents
Log: UserParameter = C:\Users\hgutsche\AppData\Roaming\FreeCAD\user.cfg
Log: Verbose = 
Log: Create Application
Log: Run App init script
Log: Init: starting
Log: Init:   Searching for modules...
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\AddonManager... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Arch... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Complete... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Draft... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Drawing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Fem... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Idf... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Image... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Import... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Inspection... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Material... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Measure... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Mesh... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\MeshPart... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\OpenSCAD... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Part... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\PartDesign... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Path... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Plot( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Points... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Raytracing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Robot... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Ship( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Show( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Sketcher... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Spreadsheet... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Start... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Surface... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\TechDraw... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Test... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Tux( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Web... done
Log: Init:      Initializing C:\Users\hgutsche\AppData\Roaming\FreeCAD\Mod\fasteners... done
Log: Init:      Initializing C:\Users\hgutsche\AppData\Roaming\FreeCAD\Mod\flamingo... done
Log: Init:      Initializing C:\Users\hgutsche\AppData\Roaming\FreeCAD\Mod\sheetmetal... done
Log: Using C:\Program Files\FreeCAD 0.18\Mod as module path!
Log: System path after init:
Log:    C:\Program Files\FreeCAD 0.18\bin
Log:    C:\Program Files\FreeCAD 0.18\Mod\AddonManager
Log:    C:\Program Files\FreeCAD 0.18\Mod\Arch
Log:    C:\Program Files\FreeCAD 0.18\Mod\Complete
Log:    C:\Program Files\FreeCAD 0.18\Mod\Draft
Log:    C:\Program Files\FreeCAD 0.18\Mod\Drawing
Log:    C:\Program Files\FreeCAD 0.18\Mod\Fem
Log:    C:\Program Files\FreeCAD 0.18\Mod\Idf
Log:    C:\Program Files\FreeCAD 0.18\Mod\Image
Log:    C:\Program Files\FreeCAD 0.18\Mod\Import
Log:    C:\Program Files\FreeCAD 0.18\Mod\Inspection
Log:    C:\Program Files\FreeCAD 0.18\Mod\Material
Log:    C:\Program Files\FreeCAD 0.18\Mod\Measure
Log:    C:\Program Files\FreeCAD 0.18\Mod\Mesh
Log:    C:\Program Files\FreeCAD 0.18\Mod\MeshPart
Log:    C:\Program Files\FreeCAD 0.18\Mod\OpenSCAD
Log:    C:\Program Files\FreeCAD 0.18\Mod\Part
Log:    C:\Program Files\FreeCAD 0.18\Mod\PartDesign
Log:    C:\Program Files\FreeCAD 0.18\Mod\Path
Log:    C:\Program Files\FreeCAD 0.18\Mod\Plot
Log:    C:\Program Files\FreeCAD 0.18\Mod\Points
Log:    C:\Program Files\FreeCAD 0.18\Mod\Raytracing
Log:    C:\Program Files\FreeCAD 0.18\Mod\Robot
Log:    C:\Program Files\FreeCAD 0.18\Mod\Ship
Log:    C:\Program Files\FreeCAD 0.18\Mod\Show
Log:    C:\Program Files\FreeCAD 0.18\Mod\Sketcher
Log:    C:\Program Files\FreeCAD 0.18\Mod\Spreadsheet
Log:    C:\Program Files\FreeCAD 0.18\Mod\Start
Log:    C:\Program Files\FreeCAD 0.18\Mod\Surface
Log:    C:\Program Files\FreeCAD 0.18\Mod\TechDraw
Log:    C:\Program Files\FreeCAD 0.18\Mod\Test
Log:    C:\Program Files\FreeCAD 0.18\Mod\Tux
Log:    C:\Program Files\FreeCAD 0.18\Mod\Web
Log:    C:\Users\hgutsche\AppData\Roaming\FreeCAD\Mod\fasteners
Log:    C:\Users\hgutsche\AppData\Roaming\FreeCAD\Mod\flamingo
Log:    C:\Users\hgutsche\AppData\Roaming\FreeCAD\Mod\sheetmetal
Log:    C:\Program Files\FreeCAD 0.18\bin\Library\bin
Log:    C:\Python37\Scripts\
Log:    C:\Python37\
Log:    C:\Perl64\site\bin
Log:    C:\Perl64\bin
Log:    C:\Program Files (x86)\Intel\iCLS Client\
Log:    C:\Program Files\Intel\iCLS Client\
Log:    C:\Windows\system32
Log:    C:\Windows
Log:    C:\Windows\System32\Wbem
Log:    C:\Windows\System32\WindowsPowerShell\v1.0\
Log:    C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\DAL
Log:    C:\Program Files\Intel\Intel(R) Management Engine Components\DAL
Log:    C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\IPT
Log:    C:\Program Files\Intel\Intel(R) Management Engine Components\IPT
Log:    c:\Program Files (x86)\ATI Technologies\ATI.ACE\Core-Static
Log:    C:\Program Files\Microsoft SQL Server\110\Tools\Binn\
Log:    C:\Program Files (x86)\Microsoft SDKs\TypeScript\1.0\
Log:    C:\Program Files\doxygen\bin
Log:    C:\Program Files (x86)\QT Lite\QTSystem
Log:    C:\Program Files\Perforce\
Log:    D:\Astronomy\SOLEX121
Log:    C:\Program Files\MiKTeX 2.9\miktex\bin\x64\
Log:    C:\Program Files\Microsoft SQL Server\130\Tools\Binn\
Log:    C:\Python37\Scripts\
Log:    C:\Python37\
Log:    C:\Perl64\site\bin
Log:    C:\Perl64\bin
Log:    C:\Program Files (x86)\Intel\iCLS Client\
Log:    C:\Program Files\Intel\iCLS Client\
Log:    C:\Windows\system32
Log:    C:\Windows
Log:    C:\Windows\System32\Wbem
Log:    C:\Windows\System32\WindowsPowerShell\v1.0\
Log:    C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\DAL
Log:    C:\Program Files\Intel\Intel(R) Management Engine Components\DAL
Log:    C:\Program Files (x86)\Intel\Intel(R) Management Engine Components\IPT
Log:    C:\Program Files\Intel\Intel(R) Management Engine Components\IPT
Log:    c:\Program Files (x86)\ATI Technologies\ATI.ACE\Core-Static
Log:    C:\Program Files\Microsoft SQL Server\110\Tools\Binn\
Log:    C:\Program Files (x86)\Microsoft SDKs\TypeScript\1.0\
Log:    C:\Program Files\doxygen\bin
Log:    C:\Program Files (x86)\QT Lite\QTSystem
Log:    C:\Program Files\Perforce\
Log:    D:\Astronomy\SOLEX121
Log:    C:\Program Files\MiKTeX 2.9\miktex\bin\x64\
Log:    C:\Program Files\Microsoft SQL Server\130\Tools\Binn\
Log:    C:\Program Files\CMake\bin
Log: Init: done
Log: Init: Creating Gui::Application and QApplication
Log: Local server 'FreeCAD' started
Log: OpenGL version is: 4.5 (4.5.13506 Compatibility Profile Context 23.20.15002.11)
Log: Run Gui init script
Log: Init: Running start script...
Log: Init:   Searching modules...
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\AddonManager... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Arch... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Complete... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Draft... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Drawing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Fem... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Idf( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Image... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Import... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Inspection... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Material... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Measure( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Mesh... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\MeshPart... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\OpenSCAD... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Part... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\PartDesign... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Path... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Plot... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Points... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Raytracing... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Robot... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Ship... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Show( not found)... ignore
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Sketcher... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Spreadsheet... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Start... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Surface... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\TechDraw... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Test... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Tux... done
Log: Init:      Initializing C:\Program Files\FreeCAD 0.18\Mod\Web... done
Log: Init:      Initializing C:\Users\hgutsche\AppData\Roaming\FreeCAD\Mod\fasteners... done
Log: Module: Part
Log: Loading Part module... done
Log: Init:      Initializing C:\Users\hgutsche\AppData\Roaming\FreeCAD\Mod\flamingo... done
Log: Init:      Initializing C:\Users\hgutsche\AppData\Roaming\FreeCAD\Mod\sheetmetal... done
Log: Init: Loading FreeCAD GUI
Log: Init: Running start script... done
Log: Init: Activating default workbench StartWorkbench
Log: Loading GUI of Web module... done
Log: Loading GUI of Start module... done
Log: Loading Start module... done
Log: QImage: XPM color specification is missing: gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcfgboayayazcjfngcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcfvbkdcdxeaeaeadvccbwgbgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgbbsdyeaeaeaeaeaeaeadwchgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcfbdeeaeaeaeaeaeaeaeaeadfcygcgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcfififififjftfsftfsfsftfsbkdgeaeaeaeaeaeaeaeaeadzbkgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcblenememepcqcqcqcqcqcqcqbebdayayayaydaeaeaeaeaeabggbgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcflcoeveveveveveveveveveveveveverbddbeaeaeaeaeadybmgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcbveqeveveveveveveveveveveueobydxeaeaeaeaeaeaddfdgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcfrcrevevevevevevevevevesbfcaeaeaeaeaeaeaeadvcjgagcgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgccxekevevevevevevevemcsfufbbzdgdxeadxducbcjfzgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgcfubbelemekereteucoffgcgcgcftcyaiakbwcvfngcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgcgccpauahalamaxbbfmgcgcgcgcgcgcanfagcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgcgcfyawabaaacaufngcgcgcgcgcgcgcaffpgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgcgcgcctajacavftgcgcgcgcgcgcgcezaogcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgcgcgcgaawavfrgcgcgcgcgcgcgceyagfpgcgcgcgcgcgcfyczgcgcgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgcgcgcgcfhfrgcgcgcgcgcfzasadapfxgcgcgcgcgcgcfzbwdrcigbgcgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgcgcgcgcgcgcgcgcgcgcfwagewfxgcfyfsficzcvcuctbkefejefboftgcgcgcgcgcgcgcgcgcgcgc","gcgcgcgcgcgcgcgcgcgcgcgcgcgcaoezfufbaybkcfdndsededceebejejejegbjbmfifzgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcaecvbrdsejejejejejejdhdqejejejejejeicecmbkfjgbgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcfybxbpebejejejejejejejdndlejejejejejejejejcndodmcwgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcftbweeejejejejejejejejdtcnejejejejejejejejejejdjdjebcwgagcgcgcgc", "gcgcgcgcgcgcgcgcgcgcftbseiejejejejejejejejedcgejejejejejejejejejejejejdocldkfjgcgcgcgc", "gcgcgcgcgcgcgcgcgcfybweiejejejejejejejejefceeiejejejejejejejejejejejejejdtcebkgcgcgcgc", "gcgcgcgcgcgcgcgcgcczdtejejejejejejejejehceegejejejejejejejejejejejejejefdqbqazgcgcgcgc", "gcgcgcgcgcgcgcgcgbbhejejejejejejejejejbqefejejejejejejejejejejehdtdhbjbndjdobkgcgcgcgc", "gcgcgcgcgcgcgcgcftchejejejejejejejejcgebejejejejejejejejdtdjbnbgcndsegejejdofegcgcgcgc", "gcgcgcgcgcgcgcgcftcfejejejejejejejdhdqejejejejejeddnbzazcldoegejejejejejehbtgbgcgcgcgc", "gcgcgcgcgcgcgcgcgbbgejejejejejejdodlejejefdocgazbzdneeejejejejejejejejejckfsgcgcgcgcgc", "gcgcgcgcgcgcgcgcgccwdtejejejejdtbqdqcnbgbqdjebejejejejejejejejejejejehckfqgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcfvcheiejejeeazbjdhdtehejejejejejejejejejejejejejdtbwfsgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcfucheeejejegejejejejejejejejejejejejejejejdsbscyfzgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcfvcidhefejejejejejejejejejejejejejejdrbmfbfvgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcfkbtbsdldtedeeejejejejeedocnbjayfcfzgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcfuficycjcjayayayaycjfeflcdatgcgcgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcatatgcgcgcgcgcgcatatgcgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcatatgcgcgcgcgcgcgcapangcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcexargcgcgcgcgcgcfoagaogcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgceyaqgcgcgcgcgcexagfogcgcgcgcgcgcgcgcgcgcgcgcgc", "gcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgceyaqgcgcgcfxaoargbgcgcgcgcgcgcgcgcgcgcgcgcgcgc", "xpmendext
Log: QImage::QImage(), XPM is not supported
Log: Init: Showing main window
Log: Main window restored
Log: Show main window
Log: Toolbars restored
Log: 3Dconnexion device not attached.
Log: Init: Entering event loop
Log: Init: Processing command line files
Log: Loading GUI of Image module... done
Log: Loading Image module... done
Log: QFSFileEngine::open: No file name specified
Err: Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
Log: The event type 12 was sent to QOpenGLWidget
Object tree:
	QOpenGLWidget is child of
	SIM::Coin3D::Quarter::QuarterWidget is child of
	QStackedWidget is child of
	Gui::View3DInventor is child of
	QMdiSubWindow is child of
	QWidget is child of
	QMdiArea is child of
	Gui::MainWindowErr: Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
Log: The event type 12 was sent to QOpenGLWidget
Object tree:
	QOpenGLWidget is child of
	SIM::Coin3D::Quarter::QuarterWidget is child of
	QStackedWidget is child of
	Gui::View3DInventor is child of
	QMdiSubWindow is child of
	QWidget is child of
	QMdiArea is child of
	Gui::MainWindowErr: Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
Log: The event type 12 was sent to QOpenGLWidget
Object tree:
	QOpenGLWidget is child of
	SIM::Coin3D::Quarter::QuarterWidget is child of
	QStackedWidget is child of
	Gui::View3DInventor is child of
	QMdiSubWindow is child of
	QWidget is child of
	QMdiArea is child of
	Gui::MainWindowErr: Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
Log: The event type 12 was sent to QOpenGLWidget
Object tree:
	QOpenGLWidget is child of
	SIM::Coin3D::Quarter::QuarterWidget is child of
	QStackedWidget is child of
	Gui::View3DInventor is child of
	QMdiSubWindow is child of
	QWidget is child of
	QMdiArea is child of
	Gui::MainWindowLog: Hide main window
Log: Finish: Event loop left
Log: Destruct Gui::Application
Log: FreeCAD terminating...
Log: Saving system parameter...
Log: Saving system parameter...done
Log: Saving user parameter...
Log: Saving user parameter...done
FreeCAD-2.log (21,394 bytes)   


2019-04-27 03:31

reporter   ~0013058

Last edited: 2019-04-29 14:31

View 2 revisions

For me the problem of change visibility (hide/show) is solved. I upload and saved the file successfully with a .png image.

Here is my results.

OS: Windows 8.1
Word size of OS: 64-bit
Word size of FreeCAD: 64-bit
Version: 0.18.16110 (Git)
Build type: Release
Branch: (HEAD detached at upstream/releases/FreeCAD-0-18)
Hash: f7dccfaa909e5b9da26bf50c4a22ccca9bb10c40
Python version: 3.6.6
Qt version: 5.6.2
Coin version: 4.0.0a
OCC version: 7.3.0

UPDATE: The only special thing that i did in between was to run the windows "Check disk" utility and it repaired some disk errors.


2019-09-20 12:32

administrator   ~0013659

Folks, can you please try to reproduce this issue on 0.19 dev version and report back?


2019-09-20 15:57

reporter   ~0013663

Latest conda build run with Integrated graphics still gives this error and does not load image:
Loading PartDesign module... done
Init: Showing main window
Main window restored
Show main window
Toolbars restored
3Dconnexion device not attached.
Init: Entering event loop
Init: Processing command line files
Loading GUI of Image module... done
Loading Image module... done
QFSFileEngine::open: No file name specified
Unhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
The event type 12 was sent to QOpenGLWidget
Object tree:
    QOpenGLWidget is child of
    SIM::Coin3D::Quarter::QuarterWidget is child of
    QStackedWidget is child of
    Gui::View3DInventor is child of
    QMdiSubWindow is child of
    QWidget is child of
    QMdiArea is child of
    Gui::MainWindowUnhandled Base::Exception caught in GUIApplication::notify.
The error message is: Access violation
The event type 12 was sent to QOpenGLWidget
Object tree:
    QOpenGLWidget is child of
    SIM::Coin3D::Quarter::QuarterWidget is child of
    QStackedWidget is child of
    Gui::View3DInventor is child of
    QMdiSubWindow is child of
    QWidget is child of
    QMdiArea is child of

OS: Windows 8.1
Word size of OS: 64-bit
Word size of FreeCAD: 64-bit
Version: 0.19.17505 (Git)
Build type: Release
Branch: master
Hash: 755536e9df94d2d39da1468420f1fd333c35da7a
Python version: 3.6.6
Qt version: 5.6.2
Coin version: 4.0.0a
OCC version: 7.3.0
Locale: Bulgarian/Bulgaria (bg_BG)

LibPack version works ok with integrated graphics.
OS: Windows 8.1 (6.3)
Word size of OS: 64-bit
Word size of FreeCAD: 64-bit
Version: 0.19.18213 (Git)
Build type: Release
Branch: master
Hash: 22babc09954ac6fda9135ee71d68550921659b1c
Python version: 3.6.8
Qt version: 5.12.1
Coin version: 4.0.0a
OCC version: 7.3.0
Locale: Bulgarian/Bulgaria (bg_BG)


2019-11-15 15:01

reporter   ~0013825

For me (Intel integrated card), in 0.19_dev (FreeCAD_0.19.18719_x64_LP_12.1.2_PY3QT5-WinVS2015) works without problems :-).

OS: Windows 10 (10.0)
Word size of OS: 64-bit
Word size of FreeCAD: 64-bit
Version: 0.19.18719 (Git)
Build type: Release
Branch: master
Hash: c021ff70debb106b27d03ed1707f4b05fcf385a6
Python version: 3.6.7
Qt version: 5.12.1
Coin version: 4.0.0a
OCC version: 7.3.0
Locale: Czech/Czech Republic (cs_CZ)


2019-11-16 18:25

developer   ~0013826

@stanicke : yes, from the forum discussions, it seems guys at Qt did a great work fixing a lot of these issues with GFX in the 12.x branch. We'll just wait a bit to ensure it is fixed on all OS, then probably this ticket will be closed. ;)


2020-01-11 12:27

administrator   ~0014045

Can we deem this closed due to upstream fixes in Qt5.12.x ?


2020-01-11 14:37

reporter   ~0014054

I checked with the latest 0.19_pre (LP version) and it works without problems for me (Intel Graphics 620 integrated card).

OS: Windows 10 (10.0)
Word size of OS: 64-bit
Word size of FreeCAD: 64-bit
Version: 0.19.19181 (Git)
Build type: Release
Branch: master
Hash: 2504247d65271b937dd5f033a0efff9c0d7bf375
Python version: 3.6.8
Qt version: 5.12.1
Coin version: 4.0.0a
OCC version: 7.3.0
Locale: Czech/Czech Republic (cs_CZ)


2020-03-27 13:17

administrator   ~0014301

Closing ticket

Issue History

Date Modified Username Field Change
2019-03-23 23:33 stanicke New Issue
2019-03-23 23:33 stanicke File Added: FreeCAD.log
2019-03-23 23:37 stanicke Note Added: 0012946
2019-03-24 07:52 kisolre Note Added: 0012947
2019-03-25 16:41 stanicke Note Added: 0012949
2019-03-25 19:33 kisolre Note Added: 0012950
2019-03-25 20:08 kisolre Note Added: 0012951
2019-03-25 20:12 kisolre Note Edited: 0012951 View Revisions
2019-03-25 20:24 stanicke Note Added: 0012952
2019-03-25 20:26 stanicke Note Added: 0012953
2019-03-26 09:55 Kunda1 Status new => feedback
2019-03-26 09:55 Kunda1 Note Added: 0012954
2019-03-26 10:38 stanicke Note Added: 0012960
2019-03-26 10:38 stanicke Status feedback => new
2019-03-26 11:20 kisolre Note Added: 0012961
2019-03-26 12:08 stanicke Note Added: 0012963
2019-04-01 20:13 Geoplace Note Added: 0012983
2019-04-03 14:49 Kunda1 Tag Attached: upstream
2019-04-03 15:03 Geoplace Note Edited: 0012983 View Revisions
2019-04-24 20:22 7ofNine File Added: FreeCAD-2.log
2019-04-24 20:22 7ofNine Note Added: 0013048
2019-04-27 03:31 Geoplace Note Added: 0013058
2019-04-29 14:31 Geoplace Note Edited: 0013058 View Revisions
2019-09-20 12:28 Kunda1 Relationship added related to 0003917
2019-09-20 12:32 Kunda1 Note Added: 0013659
2019-09-20 12:33 Kunda1 Tag Attached: #pending
2019-09-20 15:57 kisolre Note Added: 0013663
2019-09-24 13:09 Kunda1 Description Updated View Revisions
2019-09-24 13:09 Kunda1 Steps to Reproduce Updated View Revisions
2019-09-24 13:10 Kunda1 Note Edited: 0012946 View Revisions
2019-10-13 11:53 openBrain Relationship added has duplicate 0004163
2019-11-15 15:01 stanicke Note Added: 0013825
2019-11-16 18:25 openBrain Note Added: 0013826
2020-01-11 12:27 Kunda1 Note Added: 0014045
2020-01-11 14:37 stanicke Note Added: 0014054
2020-03-27 13:16 Kunda1 Tag Detached: #pending
2020-03-27 13:17 Kunda1 Status new => closed
2020-03-27 13:17 Kunda1 Resolution open => fixed
2020-03-27 13:17 Kunda1 Note Added: 0014301